How to mutate using BsmBI-mediated Golden Gate assembly¶
During Golden Gate assembly, the parts cloned into the pYTK001 entry vector often have BsaI or BsmBI sites that we want to remove by mutation, or introduce some mutation that is not in our PCR template. To do this using multi-piece BsmBI cloning instead of Gibson assembly, follow the steps below:
-
Select 15nt on either side of the site you want to mutate.
-
Then input this to this script after downloading it to your computer as follows:
find_moclo_overhangs gacatctggaatctggagaccaggga
-
The above will spit out the BsmBI-cut sites that are suitable for cloning as follows:
GGAG at pos 15. GAAT at pos 9. TGGA at pos 7. AGAC at pos 17.
-
Ignore the cut sites that you want to mutate. For example, the cut sites at position 15 and 17 are unsuitable because they are part of the BsaI site that we want to mutate.
-
Then select the region starting from the cut site to 17 nt after the last mutation site. Make this the forward primer while adding BsmBI overhang
GCATCGTCTCA
and introducing the desired mutation. -
Similarly select the region starting from the cut site to 17 nt preceding the last mutation site. Make this the reverse primer while adding he BsmBI overhang
ATGCCGTCTCA
and introducing the mutation. -
Note that you will have to introduce the mutation in only the forward or the reverse primer but not both.
-
A schematic of the primer designed using the above rules to mutate out the indicated BsaI site: